The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Systemic loss of CD36 aggravates NAFLD-related HCC through MEK1/2-ERK1/2 signaling pathway.

BACKGROUND & AIMS: CD36, a membrane protein widely present in various tissues, is crucial role in regulating energy metabolism. The rise of HCC as a notable outcome of NAFLD is becoming more apparent. Patients with hereditary CD36 deficiency are at increased risk of NAFLD. However, the impact of CD36 deficiency on NAFLD-HCC remains unclear. METHODS: Global CD36 knockout mice (CD36KO) and wild type mice (WT) were induced to establish NAFLD-HCC model by N-nitrosodiethylamine (DEN) plus high fat diet (HFD). Transcriptomics was employed to examine genes that were expressed differentially. RESULTS: Compared to WT mice, CD36KO mice showed more severe HFD-induced liver issues and increased tumor malignancy. The MEK1/2-ERK1/2 pathway activation was detected in the liver tissues of CD36KO mice using RNA sequencing and Western blot analysis. CONCLUSION: Systemic loss of CD36 leaded to the advancement of NAFLD to HCC by causing lipid disorders and metabolic inflammation, a process that involves the activation of MAPK signaling pathway. We found that CD36 contributes significantly to the maintenance of metabolic homeostasis in NAFLD-HCC.

Frequency, clinical, and laboratory findings of platelet secretion disorders in patients referred to the specialized coagulation laboratory of the Iranian Blood Transfusion Organization.

OBJECTIVES: Platelet secretion disorders (PSDs) are a subgroup of platelet function disorders (PFDs) caused by defects in the content or release of platelet granules. These patients have a variable degree of mucocutaneous bleeding tendency. The diagnostic facilities of PSDs are imitated in Iran, even in specialized coagulation laboratories. The present study aims to estimate the frequency of PSDs among patients referred to the Iranian Blood Transfusion Organization (IBTO). METHODS: The research population includes all patients referred to the specialized coagulation laboratory of IBTO and requested platelet function and von Willebrand testing by their physicians. They were recruited between May 2022 and October 2022 if they were not diagnosed as having procoagulant defects, von Willebrand disease (VWD), Glanzmann thrombasthenia (GT), Bernard-Soulier syndrome (BSS), and platelet count <100 × 10 9 (except in the syndromic forms). Patients with a defect in response to at least two agonists in Light transmission aggregometry (LTA), one agonist in the ATP-secretion study, and/or impairment in the expression of CD62P are considered PSDs. RESULTS: Among 121 cases referred to our center over 6 months, 40 patients fulfilled the inclusion and exclusion criteria. Ten patients were diagnosed with PSDs. Six were classified as δ-platelet secretion disorders (δ-PSD), two α-platelet secretion disorders (α-PSD), and two αδ-platelet secretion disorders (αδ-PSD). CONCLUSIONS: The prevalence of PSDs in our population study was 25% (10/40), which seems highly prevalent. Therefore, expanding laboratory approaches to platelet function defects is necessary as a routine in our country.

ORAI1 inhibition as an efficient preclinical therapy for tubular aggregate myopathy and Stormorken syndrome.

Tubular aggregate myopathy (TAM) and Stormorken syndrome (STRMK) are clinically overlapping disorders characterized by childhood-onset muscle weakness and a variable occurrence of multisystemic signs, including short stature, thrombocytopenia, and hyposplenism. TAM/STRMK is caused by gain-of-function mutations in the Ca2+ sensor STIM1 or the Ca2+ channel ORAI1, both of which regulate Ca2+ homeostasis through the ubiquitous store-operated Ca2+ entry (SOCE) mechanism. Functional experiments in cells have demonstrated that the TAM/STRMK mutations induce SOCE overactivation, resulting in excessive influx of extracellular Ca2+. There is currently no treatment for TAM/STRMK, but SOCE is amenable to manipulation. Here, we crossed Stim1R304W/+ mice harboring the most common TAM/STRMK mutation with Orai1R93W/+ mice carrying an ORAI1 mutation partially obstructing Ca2+ influx. Compared with Stim1R304W/+ littermates, Stim1R304W/+Orai1R93W/+ offspring showed a normalization of bone architecture, spleen histology, and muscle morphology; an increase of thrombocytes; and improved muscle contraction and relaxation kinetics. Accordingly, comparative RNA-Seq detected more than 1,200 dysregulated genes in Stim1R304W/+ muscle and revealed a major restoration of gene expression in Stim1R304W/+Orai1R93W/+ mice. Altogether, we provide physiological, morphological, functional, and molecular data highlighting the therapeutic potential of ORAI1 inhibition to rescue the multisystemic TAM/STRMK signs, and we identified myostatin as a promising biomarker for TAM/STRMK in humans and mice.

Altered platelet-megakaryocyte endocytosis and trafficking of albumin and fibrinogen in RUNX1 haplodeficiency.

ABSTRACT: Platelet α-granules have numerous proteins, some synthesized by megakaryocytes (MK) and others not synthesized but incorporated by endocytosis, an incompletely understood process in platelets/MK. Germ line RUNX1 haplodeficiency, referred to as familial platelet defect with predisposition to myeloid malignancies (FPDMMs), is associated with thrombocytopenia, platelet dysfunction, and granule deficiencies. In previous studies, we found that platelet albumin, fibrinogen, and immunoglobulin G (IgG) were decreased in a patient with FPDMM. We now show that platelet endocytosis of fluorescent-labeled albumin, fibrinogen, and IgG is decreased in the patient and his daughter with FPDMM. In megakaryocytic human erythroleukemia (HEL) cells, small interfering RNA RUNX1 knockdown (KD) increased uptake of these proteins over 24 hours compared with control cells, with increases in caveolin-1 and flotillin-1 (2 independent regulators of clathrin-independent endocytosis), LAMP2 (a lysosomal marker), RAB11 (a marker of recycling endosomes), and IFITM3. Caveolin-1 downregulation in RUNX1-deficient HEL cells abrogated the increased uptake of albumin, but not fibrinogen. Albumin, but not fibrinogen, partially colocalized with caveolin-1. RUNX1 KD resulted in increased colocalization of albumin with flotillin and fibrinogen with RAB11, suggesting altered trafficking of both proteins. The increased uptake of albumin and fibrinogen, as well as levels of caveolin-1, flotillin-1, LAMP2, and IFITM3, were recapitulated by short hairpin RNA RUNX1 KD in CD34+-derived MK. To our knowledge, these studies provide first evidence that platelet endocytosis of albumin and fibrinogen is impaired in some patients with RUNX1-haplodeficiency and suggest that megakaryocytes have enhanced endocytosis with defective trafficking, leading to loss of these proteins by distinct mechanisms. This study provides new insights into mechanisms governing endocytosis and α-granule deficiencies in RUNX1-haplodeficiency.

Pathophysiology of Trauma-Induced Coagulopathy.

Trauma-induced coagulopathy (TIC) is a complex hemostatic disturbance that can develop early after a major injury. There is no universally accepted definition of TIC. However, TIC primarily refers to the inability to achieve sufficient hemostasis in severely injured trauma patients, resulting in diffuse microvascular and life-threatening bleeding. Endogenous TIC is driven by the combination of hypovolemic shock and substantial tissue injury, resulting in endothelial damage, glycocalyx shedding, upregulated fibrinolysis, fibrinogen depletion, altered thrombin generation, and platelet dysfunction. Exogenous factors such as hypothermia, acidosis, hypokalemia, and dilution due to crystalloid and colloid fluid administration can further exacerbate TIC. Established TIC upon emergency room admission is a prognostic indicator and is strongly associated with poor outcomes. It has been shown that patients with TIC are prone to higher bleeding tendencies, increased requirements for allogeneic blood transfusion, higher complication rates such as multi-organ failure, and an almost fourfold increase in mortality. Thus, early recognition and individualized treatment of TIC is a cornerstone of initial trauma care. However, patients who survive the initial insult switch from hypocoagulability to hypercoagulability, also termed "late TIC," with a high risk of developing thromboembolic complications.

Efficacy of novel agents against cellular models of familial platelet disorder with myeloid malignancy (FPD-MM).

Germline, mono-allelic mutations in RUNX1 cause familial platelet disorder (RUNX1-FPD) that evolves into myeloid malignancy (FPD-MM): MDS or AML. FPD-MM commonly harbors co-mutations in the second RUNX1 allele and/or other epigenetic regulators. Here we utilized patient-derived (PD) FPD-MM cells and established the first FPD-MM AML cell line (GMR-AML1). GMR-AML1 cells exhibited active super-enhancers of MYB, MYC, BCL2 and CDK6, augmented expressions of c-Myc, c-Myb, EVI1 and PLK1 and surface markers of AML stem cells. In longitudinally studied bone marrow cells from a patient at FPD-MM vs RUNX1-FPD state, we confirmed increased chromatin accessibility and mRNA expressions of MYB, MECOM and BCL2 in FPD-MM cells. GMR-AML1 and PD FPD-MM cells were sensitive to homoharringtonine (HHT or omacetaxine) or mebendazole-induced lethality, associated with repression of c-Myc, EVI1, PLK1, CDK6 and MCL1. Co-treatment with MB and the PLK1 inhibitor volasertib exerted synergistic in vitro lethality in GMR-AML1 cells. In luciferase-expressing GMR-AML1 xenograft model, MB, omacetaxine or volasertib monotherapy, or co-treatment with MB and volasertib, significantly reduced AML burden and improved survival in the immune-depleted mice. These findings highlight the molecular features of FPD-MM progression and demonstrate HHT, MB and/or volasertib as effective agents against cellular models of FPD-MM.

Flow-chamber device (T-TAS) to diagnose patients suspected of platelet function defects.

BACKGROUND: Patients suspected of platelet function defects represent a diagnostic challenge for the clinical laboratory, mainly due to the complexity and poor standardization of screening methods. We compared a new flow-based chip-equipped point-of-care (T-TAS) device with lumi-aggregometry and other specific tests. MATERIALS AND METHODS: The study included 96 patients suspected of platelet function defects and 26 patients referred to hospital for an evaluation of residual platelet function while on antiplatelet therapy. RESULTS: Forty-eight of 96 patients displayed abnormal platelet function by lumi-aggregometry, and 10 of them had defective granule content and were classified as δ-storage pool disease (δ-SPD). T-TAS compared favorably with lumi-aggregometry in detecting the most severe forms of platelet function defects (i.e., δ-SPD) [test agreement (lumi-light transmission aggregometry [lumi-LTA] vs T-TAS) for the δ-SPD subgroup was 80% and K CHOEN 0.695. T-TAS was less sensitive to milder platelet function defects (i.e., primary secretion defects [PSD]). Concerning patients on antiplatelets, test agreement (lumi-LTA vs T-TAS) in detecting patients who were responders to this therapy was 54%; K CHOEN 0.150. DISCUSSION: The results indicate that T-TAS can detect the more severe forms of platelet function defects such as δ-SPD. There is limited agreement of T-TAS with lumi-aggregometry in identifying responders to antiplatelets. However, this poor agreement is commonly shared by lumi-aggregometry and other devices owing to the lack of test specificity and of prospective data from clinical trials linking platelet function with therapeutic efficacy.

Bleeding phenotype and hemostatic evaluation by thrombin generation in children with Noonan syndrome: A prospective study.

BACKGROUND: This study aimed to evaluate the bleeding phenotype and to conduct a comprehensive hemostatic evaluation in individuals with Noonan syndrome (NS), a dominantly inherited disorder caused by pathogenic variants in genes associated with the Ras/MAPK signaling pathway. METHODS: Children with a genetically confirmed diagnosis of NS underwent clinical evaluation, routine laboratory tests, platelet function testing, and thrombin generation (TG) assessment. RESULTS: The study included 24 children. The most frequently reported bleeding symptoms were easy bruising and epistaxis, while bleeding complications were observed in 15% of surgical procedures. Various hemostatic abnormalities were identified, including platelet dysfunction, von Willebrand disease, and clotting factor deficiencies. Abnormal platelet function was observed in 50% of the patients, and significantly lower TG parameters were found compared to controls. However, no significant correlation was observed between bleeding symptoms and TG results. CONCLUSIONS: The study suggests that the bleeding diathesis in NS is multifactorial, involving both platelet dysfunction and deficiencies of plasma coagulation factors. The potential role of TG assay as an ancillary tool for predicting bleeding tendencies in individuals with NS undergoing surgery warrants further investigation.

Utility of the international society on thrombosis and hemostasis-bleeding assessment tool in the diagnosis of patients who suspected of platelet function disorders.

The ISTH-BAT is a structured bleeding assessment tool to record and help diagnose patients with possible bleeding disorders. However, a few studies evaluated the utility of ISTH-BAT in diagnosing patients with platelet function defects (PFDs). In this study, we evaluated the diagnostic utility of ISTH-BAT in predicting PFDs among patients suspected of PFDs. Forty patients suspected of PFDs and 21 normal healthy controls were evaluated by the ISTH-BAT scoring system, light transmission aggregometry (LTA), ATP-releasing assays (lumi-aggregometry), and expression of CD62P for diagnosis of PFDs. Among 40 patients suspected of PFDs, 10 were diagnosed as PFDs using lumiaggregometry and CD62P. The ISTH-BAT score in patients suspected of PFDs [(6, interquartile range (IQR) 1-8] and patients with PFDs was significantly higher than the control group (0; IQR 0-0) ( P  < 0.001). Receiver operating characteristic curves indicate that ISTH-BAT is not able to discriminate patients with PFDs from those without PFDs (areas under the curve of 0.620 (95% confidence interval 0.415-0.825). The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of the ISTH-BAT in predicting the presence of PFDs, respectively, were 40, 73.3, 33.3, and 78.6% in the cut-off ISTH-BAT at least 4 in adult men, at least 6 in adult women, and at least 3 in children (age < 18). The ISTH-BAT scoring system has good discriminatory power in diagnosing patients with PFDs from healthy controls but is ineffective in differentiating them from those without PFDs.

Genomic landscape of patients with germline RUNX1 variants and familial platelet disorder with myeloid malignancy.

ABSTRACT: Familial platelet disorder with associated myeloid malignancies (FPDMM) is caused by germline RUNX1 mutations and characterized by thrombocytopenia and increased risk of hematologic malignancies. We recently launched a longitudinal natural history study for patients with FPDMM. Among 27 families with research genomic data by the end of 2021, 26 different germline RUNX1 variants were detected. Besides missense mutations enriched in Runt homology domain and loss-of-function mutations distributed throughout the gene, splice-region mutations and large deletions were detected in 6 and 7 families, respectively. In 25 of 51 (49%) patients without hematologic malignancy, somatic mutations were detected in at least 1 of the clonal hematopoiesis of indeterminate potential (CHIP) genes or acute myeloid leukemia (AML) driver genes. BCOR was the most frequently mutated gene (in 9 patients), and multiple BCOR mutations were identified in 4 patients. Mutations in 6 other CHIP- or AML-driver genes (TET2, DNMT3A, KRAS, LRP1B, IDH1, and KMT2C) were also found in ≥2 patients without hematologic malignancy. Moreover, 3 unrelated patients (1 with myeloid malignancy) carried somatic mutations in NFE2, which regulates erythroid and megakaryocytic differentiation. Sequential sequencing data from 19 patients demonstrated dynamic changes of somatic mutations over time, and stable clones were more frequently found in older adult patients. In summary, there are diverse types of germline RUNX1 mutations and high frequency of somatic mutations related to clonal hematopoiesis in patients with FPDMM. Monitoring changes in somatic mutations and clinical manifestations prospectively may reveal mechanisms for malignant progression and inform clinical management. This trial was registered at www.clinicaltrials.gov as #NCT03854318.

Evaluating the clinical validity of genes related to hemostasis and thrombosis using the Clinical Genome Resource gene curation framework.

BACKGROUND: Inherited bleeding, thrombotic, and platelet disorders (BTPDs) are a heterogeneous set of diseases, many of which are very rare globally. Over the past 5 decades, the genetic basis of some of these disorders has been identified, and recently, high-throughput sequencing has become the primary means of identifying disease-causing genetic variants. OBJECTIVES: Knowledge of the clinical validity of a gene-disease relationship is essential to provide an accurate diagnosis based on results of diagnostic gene panel tests and inform the construction of such panels. The Scientific and Standardization Committee for Genetics in Thrombosis and Hemostasis undertook a curation process for selecting 96 TIER1 genes for BTPDs. The purpose of the process was to evaluate the evidence supporting each gene-disease relationship and provide an expert-reviewed classification for the clinical validity of genes associated with BTPDs. METHODS: The Clinical Genome Resource (ClinGen) Hemostasis/Thrombosis Gene Curation Expert Panel assessed the strength of evidence for TIER1 genes using the semiquantitative ClinGen gene-disease clinical validity framework. ClinGen Lumping and Splitting guidelines were used to determine the appropriate disease entity or entities for each gene, and 101 gene-disease relationships were identified for curation. RESULTS: The final outcome included 68 Definitive (67%), 26 Moderate (26%), and 7 Limited (7%) classifications. The summary of each curation is available on the ClinGen website. CONCLUSION: Expert-reviewed assignment of gene-disease relationships by the ClinGen Hemostasis/Thrombosis Gene Curation Expert Panel facilitates accurate molecular diagnoses of BTPDs by clinicians and diagnostic laboratories. These curation efforts can allow genetic testing to focus on genes with a validated role in disease.

Description of an In Vitro Platelet Function Analyzer-PFA-100™.

This manuscript represents a republication of a manuscript originally published in STH in 1995. This republication is to help celebrate 50 years of publishing for STH. The original abstract follows.A new in vitro system for the detection of platelet dysfunction, PFA-100®, has been developed. It provides a quantitative measure of platelet function in anticoagulated whole blood. The system comprises a microprocessor-controlled instrument and a disposable test cartridge containing a biologically active membrane. The instrument aspirates a blood sample under constant vacuum from the sample reservoir through a capillary and a microscopic aperture cut into the membrane. The membrane is coated with collagen and epinephrine or adenosine 5'-diphosphate. The presence of these biochemical stimuli, and the high shear rates generated under the standardized flow conditions, result in platelet attachment, activation, and aggregation, slowly building a stable platelet plug at the aperture. The time required to obtain full occlusion of the aperture is reported as the "closure time." We have found that impairment of von Willebrand factor, or inhibition of platelet receptors glycoprotein Ib or IIb/IIIa with monoclonal antibodies or peptides, resulted in abnormal closure times. An antifibrinogen antibody, in contrast, failed to show any effect. The test appears to be sensitive to platelet adherence and aggregation abnormalities. The PFA-100® system has potential applications in routine evaluation of platelet function in the clinical setting because of its accuracy, case of operation, and rapid turnaround of results.

A novel GATA1 variant p.G229D causing the defect of procoagulant platelet formation.

INTRODUCTION: GATA1 is one of the master transcription factors in hematopoietic lineages development which is crucial for megakaryocytic differentiation and maturation. Previous studies have shown that distinct GATA1 variants are associated with varying severities of macrothrombocytopenia and platelet dysfunction. OBJECTIVE: To determine the underlying pathological mechanisms of a novel GATA1 variant (c. 686G > A, p. G229D) in a patient with recurrent traumatic muscle hematomas. METHODS: Comprehensive phenotypic analysis of the patient platelets was performed. Procoagulant platelet formation and function were detected using flow cytometry assay and thrombin generation test (TGT), respectively. The ANO6 expression was measured by qPCR and western blot. The intracellular supramaximal calcium flux was detected by Fluo-5N fluorescent assay. RESULTS: The patient displayed mild macrothrombocytopenia with defects of platelet granules, aggregation, and integrin αIIbß3 activation. The percentage of the procoagulant platelet formation of the patient upon the stimulation of thrombin plus collagen was lower than that of the healthy controls (40.9 % vs 49.0 % ± 5.1 %). The patient platelets exhibited a marked reduction of thrombin generation in platelet rich plasma TGT compared to the healthy controls (peak value: ∼70 % of the healthy controls; the endogenous thrombin potential: ∼40 % of the healthy controls). The expression of ANO6 and intracellular calcium flux were impaired, which together with abnormal granules of the patient platelets might contribute to defect of procoagulant platelet function. CONCLUSIONS: The G229D variant could lead to a novel platelet phenotype characterized by defective procoagulant platelet formation and function, which extended the range of GATA1 variants associated platelet disorders.

Evaluation of a diagnostic platelet aggregation test strategy for platelet rich plasma samples with low platelet counts.

INTRODUCTION: Light transmission aggregometry (LTA) is important for diagnosing platelet function disorders (PFD) and von Willebrand disease (VWD) affecting ristocetin-induced platelet aggregation (RIPA). Nonetheless, data is lacking on the utility of LTA for investigating thrombocytopenic patients and platelet rich plasma samples with low platelet counts (L-PRP). Previously, we developed a strategy for diagnostic LTA assessment of L-PRP that included: (1) acceptance of referrals/samples, regardless of thrombocytopenia severity, (2) tailored agonist selection, based on which are informative for L-PRP with mildly or severely low platelet counts, and (3) interpretation of maximal aggregation (MA) using regression-derived 95% confidence intervals, determined for diluted control L-PRP (C-L-PRP). METHODS: To further evaluate the L-PRP LTA strategy, we evaluated findings for a subsequent patient cohort. RESULTS: Between 2008 and 2021, the L-PRP strategy was applied to 211 samples (11.7% of all LTA samples) from 192 unique patients, whose platelet counts (median [range] × 109 /L) for blood and L-PRP were: 105 [13-282; 89% with thrombocytopenia] and 164 [17-249], respectively. Patient-L-PRP had more abnormal MA findings than simultaneously tested C-L-PRP (p-values <0.001). Among patients with accessible electronic medical records (n = 181), L-PRP LTA uncovered significant aggregation abnormalities in 45 (24.9%), including 18/30 (60%) with <80 × 109 platelets/L L-PRP, and ruled out PFD, and VWD affecting RIPA, in others. The L-PRP LTA strategy helped diagnose VWD affecting RIPA, Bernard Soulier syndrome, familial platelet disorder with myeloid malignancy, suspected ITGA2B/ITGB3-related thrombocytopenia, and acquired PFD. CONCLUSION: Diagnostic LTA with L-PRP, using a strategy that considers thrombocytopenia severity, is feasible and informative.

Glanzmann's thrombasthenia associated with gastrointestinal angiodysplasias successfully treated with bevacizumab.

Glanzmann's Thrombasthenia (GT) is a rare hemorrhagic condition caused by a platelet surface receptor disorder of the glycoprotein (GP) IIb/IIIa. Symptoms of GT are various forms of hemorrhages, such as purpura, epistaxis and menorrhagia. Gastrointestinal bleeding (GIB) is a rare expression of the condition and may occur due to traumas in the GI tract or as a consequence of gastrointestinal angiodysplasia (GIADs). In this case report, we present a middle-aged woman with recurrent GIB consequent to GIADs with persistent melena and iron deficiency anemia. After several unsuccessful therapeutic interventions, the patient was studied by the hereditary hemorrhagic telangiectasia's (HHT - Osler-Weber-Rendu disease) unit, where she received bevacizumab, showing a complete improvement in symptoms as well as a reduction in her GIADs. This case shows that bevacizumab could be a possible line of treatment for patients with coagulation disorders with GIADs.

Humanized mouse models for inherited thrombocytopenia studies.

Inherited thrombocytopenia (IT) is a group of hereditary disorders characterized by a reduced platelet count as the main clinical manifestation, and often with abnormal platelet function, which can subsequently lead to impaired hemostasis. In the past decades, humanized mouse models (HMMs), that are mice engrafted with human cells or genes, have been widely used in different research areas including immunology, oncology, and virology. With advances of the development of immunodeficient mice, the engraftment, and reconstitution of functional human platelets in HMM permit studies of occurrence and development of platelet disorders including IT and treatment strategies. This article mainly reviews the development of humanized mice models, the construction methods, research status, and problems of using humanized mice for the in vivo study of human thrombopoiesis.

Humanized mouse models (HMMs) refer to immunodeficient mice that have been used for the investigation of human hematopoiesis and immunity for years. With engrafted human hematopoietic stem cells (HSCs), the differentiation process of HSCs and re-construction of platelets can be monitored in the mice. Until now, several strains of HMMs have been used in the studies of inherited thrombocytopenia (IT), a genetic disorder associated with low platelet count in the blood. In this study, we reviewed the development of these HMMs in IT studies, compared the different sources of HSCs transplanted into HMMs and summarize the strategies of HSC transplantation in HMMs. The Kit^−/− immunodeficient mice showed effectively long-term and stable implantation of human HSC without irradiation and higher implantation levels, and they also support multilinear differentiation of human HSC, such as platelets and red blood cells. The source and count of HSCs and the transplantation strategy may also impact the result. This study provides a basis information for HMMs used in IT and will help other investigators in this field choosing the right research plan.